macsquant running buffer (Miltenyi Biotec)
Miltenyi Biotec is a verified supplier 
Miltenyi Biotec manufactures this product 
95
Structured Review
Miltenyi Biotec
macsquant running buffer
Macsquant Running Buffer, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/macsquant+running+buffer/MACSQuant+Running+Buffer/pm42508561-81-14-17
Average 95 stars, based on 89 article reviews
Macsquant Running Buffer, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/macsquant+running+buffer/MACSQuant+Running+Buffer/pm42508561-81-14-17
Average 95 stars, based on 89 article reviews
macsquant running buffer - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Flow Cytometry:Article Title: High-throughput screening approach identifies substrate-selective Hsp104 variants that counter amyloid seeding with diminished off-target effects. Article Snippet: .. Cells for flow cytometry were fixed in 4% paraformaldehyde (Thermo Fisher) and resuspended in Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with CMC:Article Title: Dual pH-Responsive Calcium Phosphate Nanoparticles Conjugated with Folate by CuAAC Click Chemistry for Targeted Gemcitabine Delivery to Cancer Cells Article Snippet: .. The following reagents were used: carboxymethylcellulose sodium salt (CMC; DS 0.7, M w ∼ 90 kDa, Sigma-Aldrich), 1-ethyl-3-(3-(dimethylamino) propyl) carbodiimide hydrochloride (EDC; ≥99%, Carl Roth), N -hydroxysuccinimide (NHS; 98%, Sigma-Aldrich), gemcitabine hydrochloride (GEM; >98%, TCI), calcium lactate pentahydrate (USP Reference Standard, Sigma-Aldrich), ammonium hydrogen phosphate ((NH 4 ) 2 HPO 4 ; ≥98%, VWR Life Science), tetraethyl orthosilicate (TEOS; 98%, Merck), CMC-BR (label degree 1:66, M w ∼ 200 kDa, Surflay Nanotec), (3-azidopropyl) triethoxysilane (97%, SelectLab Chemicals), ( S )-17-(4-(((2-amino-4-oxo-3,4-dihydropteridin-6-yl) methyl) amino) benzamido)-14-oxo-4,7,10-trioxa-13-azaoctadec-1-yn-18-oic acid (Folate-PEG3-propargyl; 97%, AmBeed), copper sulfate pentahydrate (CuSO 4 ·5H 2 O; 99%, AppliChem), tris (3-hydroxypropyl-triazolylmethyl) amine (THPTA; 95%, Sigma-Aldrich), aminoguanidine hydrogen carbonate (98+%, Alfa Aesar), sodium ascorbate (≥99%, Sigma-Aldrich), potassium bromide (KBr; Sigma-Aldrich), dimethylformamide (DMF; Fisher Scientific), dimethyl sulfoxide (DMSO; Fisher Scientific), absolute ethanol (Fisher Scientific), ammonia solution (30%, Carl Roth), sodium hydroxide (NaOH; 0.1 M, Bernd Kraft), glacial acetic acid (Fisher Scientific), deuterium oxide (D 2 O; 99.9%, Deutero), chloride acid solution (HCl; 1 M, Bernd Kraft), Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Thermo Fisher Scientific), fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific), RPMI 1640 (Gibco, Thermo Fisher Scientific), penicillin (Gibco, Thermo Fisher Scientific), streptomycin (Gibco, Thermo Fisher Scientific), GlutaMAX (Gibco, Thermo Fisher Scientific), Dulbecco’s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher Scientific), TrypLE Express Enzyme (Gibco, Thermo Fisher Scientific), hexamethyldisilazane (HMDS; Sigma-Aldrich), Modification:Article Title: Dual pH-Responsive Calcium Phosphate Nanoparticles Conjugated with Folate by CuAAC Click Chemistry for Targeted Gemcitabine Delivery to Cancer Cells Article Snippet: .. The following reagents were used: carboxymethylcellulose sodium salt (CMC; DS 0.7, M w ∼ 90 kDa, Sigma-Aldrich), 1-ethyl-3-(3-(dimethylamino) propyl) carbodiimide hydrochloride (EDC; ≥99%, Carl Roth), N -hydroxysuccinimide (NHS; 98%, Sigma-Aldrich), gemcitabine hydrochloride (GEM; >98%, TCI), calcium lactate pentahydrate (USP Reference Standard, Sigma-Aldrich), ammonium hydrogen phosphate ((NH 4 ) 2 HPO 4 ; ≥98%, VWR Life Science), tetraethyl orthosilicate (TEOS; 98%, Merck), CMC-BR (label degree 1:66, M w ∼ 200 kDa, Surflay Nanotec), (3-azidopropyl) triethoxysilane (97%, SelectLab Chemicals), ( S )-17-(4-(((2-amino-4-oxo-3,4-dihydropteridin-6-yl) methyl) amino) benzamido)-14-oxo-4,7,10-trioxa-13-azaoctadec-1-yn-18-oic acid (Folate-PEG3-propargyl; 97%, AmBeed), copper sulfate pentahydrate (CuSO 4 ·5H 2 O; 99%, AppliChem), tris (3-hydroxypropyl-triazolylmethyl) amine (THPTA; 95%, Sigma-Aldrich), aminoguanidine hydrogen carbonate (98+%, Alfa Aesar), sodium ascorbate (≥99%, Sigma-Aldrich), potassium bromide (KBr; Sigma-Aldrich), dimethylformamide (DMF; Fisher Scientific), dimethyl sulfoxide (DMSO; Fisher Scientific), absolute ethanol (Fisher Scientific), ammonia solution (30%, Carl Roth), sodium hydroxide (NaOH; 0.1 M, Bernd Kraft), glacial acetic acid (Fisher Scientific), deuterium oxide (D 2 O; 99.9%, Deutero), chloride acid solution (HCl; 1 M, Bernd Kraft), Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Thermo Fisher Scientific), fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific), RPMI 1640 (Gibco, Thermo Fisher Scientific), penicillin (Gibco, Thermo Fisher Scientific), streptomycin (Gibco, Thermo Fisher Scientific), GlutaMAX (Gibco, Thermo Fisher Scientific), Dulbecco’s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher Scientific), TrypLE Express Enzyme (Gibco, Thermo Fisher Scientific), hexamethyldisilazane (HMDS; Sigma-Aldrich), Saline:Article Title: Dual pH-Responsive Calcium Phosphate Nanoparticles Conjugated with Folate by CuAAC Click Chemistry for Targeted Gemcitabine Delivery to Cancer Cells Article Snippet: .. The following reagents were used: carboxymethylcellulose sodium salt (CMC; DS 0.7, M w ∼ 90 kDa, Sigma-Aldrich), 1-ethyl-3-(3-(dimethylamino) propyl) carbodiimide hydrochloride (EDC; ≥99%, Carl Roth), N -hydroxysuccinimide (NHS; 98%, Sigma-Aldrich), gemcitabine hydrochloride (GEM; >98%, TCI), calcium lactate pentahydrate (USP Reference Standard, Sigma-Aldrich), ammonium hydrogen phosphate ((NH 4 ) 2 HPO 4 ; ≥98%, VWR Life Science), tetraethyl orthosilicate (TEOS; 98%, Merck), CMC-BR (label degree 1:66, M w ∼ 200 kDa, Surflay Nanotec), (3-azidopropyl) triethoxysilane (97%, SelectLab Chemicals), ( S )-17-(4-(((2-amino-4-oxo-3,4-dihydropteridin-6-yl) methyl) amino) benzamido)-14-oxo-4,7,10-trioxa-13-azaoctadec-1-yn-18-oic acid (Folate-PEG3-propargyl; 97%, AmBeed), copper sulfate pentahydrate (CuSO 4 ·5H 2 O; 99%, AppliChem), tris (3-hydroxypropyl-triazolylmethyl) amine (THPTA; 95%, Sigma-Aldrich), aminoguanidine hydrogen carbonate (98+%, Alfa Aesar), sodium ascorbate (≥99%, Sigma-Aldrich), potassium bromide (KBr; Sigma-Aldrich), dimethylformamide (DMF; Fisher Scientific), dimethyl sulfoxide (DMSO; Fisher Scientific), absolute ethanol (Fisher Scientific), ammonia solution (30%, Carl Roth), sodium hydroxide (NaOH; 0.1 M, Bernd Kraft), glacial acetic acid (Fisher Scientific), deuterium oxide (D 2 O; 99.9%, Deutero), chloride acid solution (HCl; 1 M, Bernd Kraft), Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Thermo Fisher Scientific), fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific), RPMI 1640 (Gibco, Thermo Fisher Scientific), penicillin (Gibco, Thermo Fisher Scientific), streptomycin (Gibco, Thermo Fisher Scientific), GlutaMAX (Gibco, Thermo Fisher Scientific), Dulbecco’s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher Scientific), TrypLE Express Enzyme (Gibco, Thermo Fisher Scientific), hexamethyldisilazane (HMDS; Sigma-Aldrich), Article Title: A Replication-Competent Flavivirus Genome with a Stable GFP Insertion at the NS1-NS2A Junction. Article Snippet: .. Cells were detached using trypsin-EDTA, washed with phosphate-buffered saline (PBS), resuspended in Article Title: A Replication-Competent Flavivirus Genome with a Stable GFP Insertion at the NS1-NS2A Junction Article Snippet: .. Cells were detached using trypsin-EDTA, washed with phosphate-buffered saline (PBS), resuspended in MTT Assay:Article Title: Dual pH-Responsive Calcium Phosphate Nanoparticles Conjugated with Folate by CuAAC Click Chemistry for Targeted Gemcitabine Delivery to Cancer Cells Article Snippet: .. The following reagents were used: carboxymethylcellulose sodium salt (CMC; DS 0.7, M w ∼ 90 kDa, Sigma-Aldrich), 1-ethyl-3-(3-(dimethylamino) propyl) carbodiimide hydrochloride (EDC; ≥99%, Carl Roth), N -hydroxysuccinimide (NHS; 98%, Sigma-Aldrich), gemcitabine hydrochloride (GEM; >98%, TCI), calcium lactate pentahydrate (USP Reference Standard, Sigma-Aldrich), ammonium hydrogen phosphate ((NH 4 ) 2 HPO 4 ; ≥98%, VWR Life Science), tetraethyl orthosilicate (TEOS; 98%, Merck), CMC-BR (label degree 1:66, M w ∼ 200 kDa, Surflay Nanotec), (3-azidopropyl) triethoxysilane (97%, SelectLab Chemicals), ( S )-17-(4-(((2-amino-4-oxo-3,4-dihydropteridin-6-yl) methyl) amino) benzamido)-14-oxo-4,7,10-trioxa-13-azaoctadec-1-yn-18-oic acid (Folate-PEG3-propargyl; 97%, AmBeed), copper sulfate pentahydrate (CuSO 4 ·5H 2 O; 99%, AppliChem), tris (3-hydroxypropyl-triazolylmethyl) amine (THPTA; 95%, Sigma-Aldrich), aminoguanidine hydrogen carbonate (98+%, Alfa Aesar), sodium ascorbate (≥99%, Sigma-Aldrich), potassium bromide (KBr; Sigma-Aldrich), dimethylformamide (DMF; Fisher Scientific), dimethyl sulfoxide (DMSO; Fisher Scientific), absolute ethanol (Fisher Scientific), ammonia solution (30%, Carl Roth), sodium hydroxide (NaOH; 0.1 M, Bernd Kraft), glacial acetic acid (Fisher Scientific), deuterium oxide (D 2 O; 99.9%, Deutero), chloride acid solution (HCl; 1 M, Bernd Kraft), Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Thermo Fisher Scientific), fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific), RPMI 1640 (Gibco, Thermo Fisher Scientific), penicillin (Gibco, Thermo Fisher Scientific), streptomycin (Gibco, Thermo Fisher Scientific), GlutaMAX (Gibco, Thermo Fisher Scientific), Dulbecco’s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher Scientific), TrypLE Express Enzyme (Gibco, Thermo Fisher Scientific), hexamethyldisilazane (HMDS; Sigma-Aldrich), Passaging:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with Suspension:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with Concentration Assay:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with |
